5.4 REPLICATION
Original Proposal:
- Watson and Crick, in their 1953 paper proposing the double helical structure of DNA, also suggested a mechanism for DNA replication.
Specific Pairing and Copying Mechanism:
- They noted that the specific pairing of nucleotides (A with T, and G with C) in the DNA double helix immediately suggested a potential mechanism for copying the genetic material.
Semiconservative DNA Replication:
- Their proposed scheme involved the separation of the two DNA strands, with each strand serving as a template for the synthesis of a new complementary strand.
- This process was termed “semiconservative DNA replication” because each resulting DNA molecule would have one parental strand and one newly synthesized strand.
Parental and Newly Synthesized Strands:
- After replication, each DNA molecule would consist of one original (parental) strand and one newly synthesized strand.
Confirmation and Significance:
- The proposal for semiconservative DNA replication provided a simple and elegant explanation for how genetic information is faithfully passed on during cell division.
- This concept has since been experimentally confirmed and is a foundational principle in molecular biology.
5.4.1 The Experimental Proof
Experimental Setup:
- E. coli bacteria were grown in a medium containing 15NH4Cl, where 15N is the heavy isotope of nitrogen. This resulted in the incorporation of 15N into newly synthesized DNA.
Density Gradient Centrifugation:
- The heavy DNA molecules containing 15N were separated from normal DNA molecules by centrifugation in a cesium chloride (CsCl) density gradient.
- Centrifugal force is the force experienced by an object rotating around a fixed axis, causing it to move away from the axis. In centrifugation, molecules with higher mass or density sediment faster due to greater resistance to the centrifugal force.
Transfer to Normal Medium:
- The cells were then transferred to a medium containing normal 14NH4Cl.
- Samples were taken at specific time intervals as the cells multiplied, and the DNA extracted from these samples was separated on CsCl gradients to measure densities.
Results:
- After one generation (20 minutes for E. coli), the extracted DNA had an intermediate density, indicating a hybrid of heavy and light DNA.
- After another generation (40 minutes), the DNA composition consisted of equal amounts of hybrid DNA and light DNA.
Prediction for 80 Minutes:
- If E. coli were allowed to grow for 80 minutes, the proportion of light and hybrid density DNA molecules would be the same as after 40 minutes, with equal amounts of hybrid and light DNA.
Confirmation in Chromosomes:
- Similar experiments using radioactive thymidine were performed on Vicia faba (faba beans) chromosomes by Taylor and colleagues, confirming semiconservative DNA replication.
5.4.2 The Machinery and the Enzymes
DNA-dependent DNA Polymerase:
- The main enzyme involved in DNA replication is DNA-dependent DNA polymerase, which uses a DNA template to catalyze the polymerization of deoxynucleotides.
- These enzymes are highly efficient and must polymerize nucleotides rapidly and accurately. Mistakes during replication can lead to mutations.
- Energetically, replication is an expensive process, and deoxyribonucleoside triphosphates serve dual purposes as substrates and provide energy for the polymerization reaction.
Replication Fork:
- Replication occurs at a replication fork, where the DNA double helix is opened up and replication proceeds in both directions.
- DNA polymerases can only catalyze polymerization in the 5′ to 3′ direction, leading to complications at the replication fork.
- One strand undergoes continuous replication (leading strand), while the other undergoes discontinuous replication (lagging strand), resulting in the synthesis of Okazaki fragments.
DNA Ligase:
- Discontinuously synthesized fragments on the lagging strand are later joined by the enzyme DNA ligase, forming a continuous strand.
Initiation of Replication:
- Replication does not initiate randomly in DNA; there are specific regions called origins of replication where replication begins.
- Failure in cell division after DNA replication can result in polyploidy, a chromosomal anomaly.
Eukaryotic Replication:
- In eukaryotes, DNA replication occurs during the S-phase of the cell cycle, and it is highly coordinated with cell division.
- Detailed mechanisms of replication initiation and processes at the origin of replication are studied in higher classes.
5.5 TRANSCRIPTION
Definition and Principle:
- Transcription is the process of copying genetic information from one strand of DNA into RNA.
- Like replication, transcription follows the principle of complementarity, where adenine (A) in DNA pairs with uracil (U) in RNA instead of thymine (T).
Selective Transcription:
- Unlike replication, where the entire DNA molecule is duplicated, only a segment of DNA and one of its strands are copied during transcription.
- The selection of which segment and which strand to transcribe requires demarcating specific boundaries.
Reasons for Single-Stranded Transcription:
- If both strands were transcribed simultaneously, they would code for RNA molecules with different sequences due to complementarity but not identicality.
- This would lead to complications in the genetic information transfer process, as one DNA segment would be coding for two different proteins.
- Additionally, simultaneous transcription of both strands would result in the formation of double-stranded RNA, preventing translation into proteins and rendering the transcription process futile.
5.5.1 Transcription Unit
5′ – AUGCAUGCAUGCAUGCAUGCAUGCA – 3′
The promoter and terminator regions flank the structural gene in a transcription unit:
Promoter: Located towards the 5′ end (upstream) of the structural gene, the promoter is a DNA sequence that provides the binding site for RNA polymerase. Its presence defines the template and coding strands.
Terminator: Positioned towards the 3′ end (downstream) of the coding strand, the terminator typically marks the end of the transcription process.
5.5.2 Transcription Unit and the Gene
Gene Definition:
- Genes are functional units of inheritance located on DNA.
- Defining genes solely based on DNA sequence is challenging due to sequences coding for tRNA or rRNA also being considered genes.
Monocistronic Structural Genes (Eukaryotes):
- Monocistronic genes have interrupted coding sequences, known as exons, and intervening sequences called introns.
- Exons are present in mature or processed RNA, while introns are not.
- This split-gene arrangement complicates the definition of a gene based on a DNA segment.
Polycistronic Structural Genes (Bacteria/Prokaryotes):
- In bacteria and prokaryotes, genes often lack introns and have uninterrupted coding sequences.
Regulatory Sequences:
- Promoter and regulatory sequences of a structural gene regulate gene expression and inheritance.
- Regulatory sequences, although not coding for RNA or protein, are sometimes referred to as regulatory genes due to their impact on gene expression.
5.5.3 Types of RNA and the process of Transcription
Types of RNA in Bacteria:
- mRNA (messenger RNA), tRNA (transfer RNA), and rRNA (ribosomal RNA) are the major types of RNA in bacteria.
- mRNA provides the template for protein synthesis, tRNA brings amino acids and reads the genetic code, and rRNAs play structural and catalytic roles during translation.
Transcription Process in Bacteria:
- Single DNA-dependent RNA polymerase catalyzes transcription of all RNA types in bacteria.
- Initiation: RNA polymerase binds to the promoter and initiates transcription using nucleoside triphosphates as substrates.
- Elongation: Polymerase polymerizes nucleotides in a template-dependent fashion following complementarity rules.
- Termination: Once the polymerase reaches the terminator region, the nascent RNA and polymerase fall off, resulting in termination.
- RNA polymerase associates transiently with initiation-factor (σ) and termination-factor (ρ) to initiate and terminate transcription, respectively.
Coupled Transcription and Translation in Bacteria:
- In bacteria, translation can begin before mRNA transcription is complete because there is no separation of cytosol and nucleus.
- Transcription and translation can be coupled in bacteria.
Complexities in Eukaryotic Transcription:
- Eukaryotes have three RNA polymerases in the nucleus (and additional ones in organelles) with distinct functions.
- RNA polymerase I transcribes rRNAs, RNA polymerase III transcribes tRNA, 5srRNA, and snRNAs, and RNA polymerase II transcribes precursor mRNA (hnRNA).
- Primary transcripts in eukaryotes contain both exons and introns and undergo processing such as splicing, capping, and tailing.
- Splicing removes introns and joins exons in a defined order to produce mature mRNA, which is transported out of the nucleus for translation.
Significance of Complexities:
- Complexities in eukaryotic transcription and processing highlight ancient genomic features and the dominance of RNA-dependent processes in evolution.
- Understanding RNA and RNA-dependent processes is increasingly important in modern biology.
5.6 GENETIC CODE
Historical Context:
- Determining the genetic code was a significant challenge, requiring collaboration across disciplines like physics, organic chemistry, biochemistry, and genetics.
- George Gamow, a physicist, proposed the idea that a combination of three nucleotides (a triplet) could code for the 20 amino acids.
Experimental Approach:
- Har Gobind Khorana’s chemical method synthesized RNA molecules with defined base combinations.
- Marshall Nirenberg’s cell-free system for protein synthesis helped decipher the code.
- Severo Ochoa’s enzyme, polynucleotide phosphorylase, aided in synthesizing RNA with defined sequences.
Key Features of Genetic Code:
- The codon is triplet, with 61 codons coding for amino acids and 3 codons serving as stop codons.
- Some amino acids are encoded by multiple codons, making the code degenerate.
- Codons are read in mRNA contiguously without punctuation.
- The code is nearly universal, with exceptions found in mitochondrial codons and some protozoans.
- AUG serves a dual function, coding for Methionine (Met) and acting as an initiator codon.
- UAA, UAG, and UGA are stop terminator codons.
Sequence Analysis:
- Given mRNA sequence: AUG UUU UUC UUC UUU UUU UUC
- Referring to the checkerboard, AUG codes for Methionine (Met).
- UUU and UUC both code for Phenylalanine (Phe).
- Therefore, the predicted amino acid sequence is: Met-Phe-Phe-Phe-Phe-Phe-Phe.
MOLECULAR BASIS OF INHERITANCE
Introduction to Genetic Code:
- Replication and transcription involve copying nucleic acids, which is conceptually straightforward due to complementarity.
- However, translation involves transferring genetic information from nucleotides to amino acids, lacking complementarity.
Proposal of the Genetic Code:
- Change in nucleic acids correlates with changes in amino acids in proteins.
- George Gamow proposed that a combination of three nucleotides (triplet code) could code for the 20 amino acids.
- This proposition posed a challenge due to the potential for generating more codons than needed.
Deciphering the Genetic Code:
- Har Gobind Khorana synthesized RNA molecules with defined base combinations.
- Marshall Nirenberg’s cell-free system for protein synthesis contributed to deciphering the code.
- Severo Ochoa’s enzyme, polynucleotide phosphorylase, aided in synthesizing RNA with defined sequences.
Features of the Genetic Code:
- The genetic code is triplet, with 61 codons coding for amino acids and 3 codons functioning as stop codons.
- Some amino acids are coded by more than one codon, making the code degenerate.
- Codons are read in mRNA in a contiguous fashion without punctuations.
- The code is nearly universal, although exceptions exist in mitochondrial codons and some protozoans.
- AUG has dual functions, serving as both Methionine and an initiator codon.
- UAA, UAG, and UGA are stop terminator codons.
Prediction of Amino Acid Sequence from mRNA:
- Given mRNA sequence: AUG UUU UUC UUC UUU UUU UUC.
- Utilize the genetic code to predict the sequence of amino acids coded by the mRNA.
5.6.1 Mutations and Genetic Code
Introduction to Mutations:
- Mutations provide insights into the relationship between genes and DNA.
- Large deletions and rearrangements in DNA segments can lead to the loss or gain of genes and functions.
Point Mutations:
- Point mutations involve changes in single base pairs.
- A classical example is the mutation in the gene for the beta globin chain, where a single base change results in sickle cell anemia.
Understanding Point Mutations with Examples:
- Using a simple example with a statement composed of triplet words:
- Inserting a letter “B” between “HAS” and “RED” and rearranging the statement.
- Inserting two letters “BI” and then three letters “BIG” at the same place and rearranging the statement each time.
- Similarly, deleting letters “R,” “E,” and “D” one by one and rearranging the statement.
- The conclusion is that insertion or deletion of one or two bases changes the reading frame from the point of insertion or deletion, leading to frameshift mutations.
Frameshift Insertion or Deletion Mutations:
- Insertion or deletion of one or two bases alters the reading frame.
- However, insertion or deletion of three or its multiples inserts or deletes one or multiple codons, affecting one or multiple amino acids, but the reading frame remains unaltered from that point onwards.
5.6.2 tRNA– the Adapter Molecule
Introduction to tRNA:
- Francis Crick proposed the existence of an adapter molecule to read the genetic code and link it to amino acids.
- This adapter molecule, known as tRNA (transfer RNA), was recognized for its role much later.
Structure of tRNA:
- tRNA has an anticodon loop that contains bases complementary to the codons in mRNA.
- It also has an amino acid acceptor end where it binds to specific amino acids.
- Each tRNA molecule is specific for a particular amino acid.
- There is a specific initiator tRNA for initiation, but there are no tRNAs for stop codons.
tRNA Structure:
- The secondary structure of tRNA resembles a cloverleaf, as depicted in Figure 5.12.
- However, in its actual structure, tRNA is a compact molecule that looks like an inverted L.